Review



coding region sequence cds  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs coding region sequence cds
    Coding Region Sequence Cds, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/Gibson+AssemblyMaster+Mix/pm41643674-823-1-15
    Average 99 stars, based on 6183 article reviews
    coding region sequence cds - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    other:

    Article Title: Embryonic lymphocytes contribute to a genetic form of autoimmune inflammation
    Article Snippet: PrePrint: et was ready to be plated or eventually sorted for the for the T-cell in vitro assay. Lin28 coding sequences (CDS) have been amplified from mouse ESC cDNA by Phusion High Fidelity PCR, according to manufacturer instructions (New England Biolab, M0530S). Primers (Lin28_Fw_AgeI:AAAAAACCGGTCTTTGCCTCCGGACTTCTCTGG; Lin28_Rv_SalI:AAAAAGTCGACAAAGACAGGGTGACACTGGGA) have been designed to obtain compatible ends for the insertion of the CDS into the hPGK.GF



    Similar Products

    95
    TaKaRa human ankrd49 coding sequence cds
    Human Ankrd49 Coding Sequence Cds, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/pDsRed2-N1+Vector/pm41821002-124-10-21
    Average 95 stars, based on 1 article reviews
    human ankrd49 coding sequence cds - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    New England Biolabs coding region sequence cds
    Coding Region Sequence Cds, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/Gibson+AssemblyMaster+Mix/pm41643674-823-1-15
    Average 99 stars, based on 1 article reviews
    coding region sequence cds - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Biotechnology Information protein coding dna sequences cds
    Protein Coding Dna Sequences Cds, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/cds+coding+gene+irf1+sequence/pmc13201573-212-1-16
    Average 86 stars, based on 1 article reviews
    protein coding dna sequences cds - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Bioneer Corporation poxin coding sequence cds fragment
    <t>Poxin</t> transgene inhibits DNA sensing-induced innate immune response. A. Schematic of cloning process. B-G. Cells were transfected with plasmid DNA (pDNA) using TransIT-2020. B. 2.5 μg and 7.5 μg of pDNA encoding Poxin or mutant Poxin (mtPoxin) were transfected into 293T cells, respectively, and FLAG-tagged proteins were detected. C. Activation of STING, TBK1, and IRF3 was analyzed by western blotting. Quantitative analysis of p-IRF3 expression level is shown. D. H151 was pre-treated 1 h before pDNA transfection, and protein expression levels were assessed after 24 h. E. Cells were transfected with pEGFP-N1, and protein expression levels were detected. F. mRNA levels of IFNB1 and ISG15 were analyzed by RT-qPCR (n = 3). G. IFN-β secretion levels were quantitatively analyzed using ELISA. (Representative western blots are shown.).
    Poxin Coding Sequence Cds Fragment, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/coding+gene+kp27+sequence/pmc12957823-56-1-9
    Average 86 stars, based on 1 article reviews
    poxin coding sequence cds fragment - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Biotechnology Information irf1 gene coding sequence cds
    Expression of <t>IRF1</t> and Type I interferon pathway-related proteins in gastric cancer cells. A : Simulation of type I interferon response in gastric cancer cells by incubating with interferon, showing increased expression of interferon pathway protein IRF1. B : Protein expression in gastric cancer cells after transfection with pcDNA3.1(+) -IRF1-HA.1 C : Protein expression in gastric cancer cells after transfection with siRNA-IRF1. D : Changes in the expression of interferon pathway proteins after overexpression or inhibition of IRF1 in gastric cancer cells
    Irf1 Gene Coding Sequence Cds, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/cds+coding+gene+irf1+sequence/pmc12799679-114-1-13
    Average 86 stars, based on 1 article reviews
    irf1 gene coding sequence cds - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Biotechnology Information coding sequences cds of crispld2
    Expression of <t>IRF1</t> and Type I interferon pathway-related proteins in gastric cancer cells. A : Simulation of type I interferon response in gastric cancer cells by incubating with interferon, showing increased expression of interferon pathway protein IRF1. B : Protein expression in gastric cancer cells after transfection with pcDNA3.1(+) -IRF1-HA.1 C : Protein expression in gastric cancer cells after transfection with siRNA-IRF1. D : Changes in the expression of interferon pathway proteins after overexpression or inhibition of IRF1 in gastric cancer cells
    Coding Sequences Cds Of Crispld2, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/cds+coding+gene+irf1+sequence/pm41514293-471-1-21
    Average 86 stars, based on 1 article reviews
    coding sequences cds of crispld2 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Biotechnology Information coding sequences cds
    Expression of <t>IRF1</t> and Type I interferon pathway-related proteins in gastric cancer cells. A : Simulation of type I interferon response in gastric cancer cells by incubating with interferon, showing increased expression of interferon pathway protein IRF1. B : Protein expression in gastric cancer cells after transfection with pcDNA3.1(+) -IRF1-HA.1 C : Protein expression in gastric cancer cells after transfection with siRNA-IRF1. D : Changes in the expression of interferon pathway proteins after overexpression or inhibition of IRF1 in gastric cancer cells
    Coding Sequences Cds, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/coding+sequences+cds/cds+coding+gene+irf1+sequence/pm41392379-54-1-23
    Average 86 stars, based on 1 article reviews
    coding sequences cds - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Poxin transgene inhibits DNA sensing-induced innate immune response. A. Schematic of cloning process. B-G. Cells were transfected with plasmid DNA (pDNA) using TransIT-2020. B. 2.5 μg and 7.5 μg of pDNA encoding Poxin or mutant Poxin (mtPoxin) were transfected into 293T cells, respectively, and FLAG-tagged proteins were detected. C. Activation of STING, TBK1, and IRF3 was analyzed by western blotting. Quantitative analysis of p-IRF3 expression level is shown. D. H151 was pre-treated 1 h before pDNA transfection, and protein expression levels were assessed after 24 h. E. Cells were transfected with pEGFP-N1, and protein expression levels were detected. F. mRNA levels of IFNB1 and ISG15 were analyzed by RT-qPCR (n = 3). G. IFN-β secretion levels were quantitatively analyzed using ELISA. (Representative western blots are shown.).

    Journal: Journal of Advanced Research

    Article Title: Enhancement of NK cell activity via DNA-sensing inhibition by Poxin transgene

    doi: 10.1016/j.jare.2025.05.058

    Figure Lengend Snippet: Poxin transgene inhibits DNA sensing-induced innate immune response. A. Schematic of cloning process. B-G. Cells were transfected with plasmid DNA (pDNA) using TransIT-2020. B. 2.5 μg and 7.5 μg of pDNA encoding Poxin or mutant Poxin (mtPoxin) were transfected into 293T cells, respectively, and FLAG-tagged proteins were detected. C. Activation of STING, TBK1, and IRF3 was analyzed by western blotting. Quantitative analysis of p-IRF3 expression level is shown. D. H151 was pre-treated 1 h before pDNA transfection, and protein expression levels were assessed after 24 h. E. Cells were transfected with pEGFP-N1, and protein expression levels were detected. F. mRNA levels of IFNB1 and ISG15 were analyzed by RT-qPCR (n = 3). G. IFN-β secretion levels were quantitatively analyzed using ELISA. (Representative western blots are shown.).

    Article Snippet: The Poxin coding sequence (CDS) fragment was synthesized by Bioneer, and the H17A mutant Poxin (mtPoxin) fragment was generated via overlapping PCR.

    Techniques: Cloning, Transfection, Plasmid Preparation, Mutagenesis, Activation Assay, Western Blot, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    Poxin protects NK-92 cells from pDNA transfection-induced innate immunity. A. Cells were transfected by electroporation with 10 μg pDNA, and mRNA dynamics were analyzed by RT-qPCR (n = 3). B. IFN-β secretion levels were quantitatively analyzed using ELISA. C. Expression levels of innate immune signaling proteins were detected by western blotting. (Representative data shown). D. Quantitative analysis of p-STING and p-TBK1 expression levels.

    Journal: Journal of Advanced Research

    Article Title: Enhancement of NK cell activity via DNA-sensing inhibition by Poxin transgene

    doi: 10.1016/j.jare.2025.05.058

    Figure Lengend Snippet: Poxin protects NK-92 cells from pDNA transfection-induced innate immunity. A. Cells were transfected by electroporation with 10 μg pDNA, and mRNA dynamics were analyzed by RT-qPCR (n = 3). B. IFN-β secretion levels were quantitatively analyzed using ELISA. C. Expression levels of innate immune signaling proteins were detected by western blotting. (Representative data shown). D. Quantitative analysis of p-STING and p-TBK1 expression levels.

    Article Snippet: The Poxin coding sequence (CDS) fragment was synthesized by Bioneer, and the H17A mutant Poxin (mtPoxin) fragment was generated via overlapping PCR.

    Techniques: Transfection, Electroporation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Expressing, Western Blot

    Poxin prolongs NK-92 cell survival and activity by reducing irradiation-induced innate immune activation. A. Cell survival rate was measured by FACS at specified times after irradiation. B. Cell proliferation rate was quantified by counting live cells. C. Cytotoxicity of effector cells against K562 cells was measured 1- and 2-days post-irradiation over a 4-hour period. D. Protein expression levels were detected by western blotting. (Representative data shown). E. Quantitative analysis of p-IRF3 expression level.

    Journal: Journal of Advanced Research

    Article Title: Enhancement of NK cell activity via DNA-sensing inhibition by Poxin transgene

    doi: 10.1016/j.jare.2025.05.058

    Figure Lengend Snippet: Poxin prolongs NK-92 cell survival and activity by reducing irradiation-induced innate immune activation. A. Cell survival rate was measured by FACS at specified times after irradiation. B. Cell proliferation rate was quantified by counting live cells. C. Cytotoxicity of effector cells against K562 cells was measured 1- and 2-days post-irradiation over a 4-hour period. D. Protein expression levels were detected by western blotting. (Representative data shown). E. Quantitative analysis of p-IRF3 expression level.

    Article Snippet: The Poxin coding sequence (CDS) fragment was synthesized by Bioneer, and the H17A mutant Poxin (mtPoxin) fragment was generated via overlapping PCR.

    Techniques: Activity Assay, Irradiation, Activation Assay, Expressing, Western Blot

    Poxin transgene enhances the cytotoxic activity of NK-92 cells. A. Cytotoxicity of NK-92 cells with and without Poxin expression against K562 cells was measured over 4 h. B-C. Cells were co-cultured with target K562 cells for indicated times. B. Apoptosis levels in effector cells were assessed by FACS. C. Protein expression levels were detected by western blotting. (Representative data shown). D-G. Cells were harvested after 24 h in culture, and extracted total RNA was analyzed by RNA sequencing. (C = mock cells; P = Pox-NK-92 cells; n = 3). D. Heatmap. E. GO analysis. F. Differentially expressed genes in NK-92 and Pox-NK-92 groups were categorized by function. G. Top 10 upstream transcription factors and target genes were analyzed by network analysis. H. NK cell activation pathway was analyzed by western blotting. (Representative data shown). I. Quantitative analysis of Perforin expression level. J. mRNA levels of cytotoxic factors were analyzed by RT-qPCR (n = 3).

    Journal: Journal of Advanced Research

    Article Title: Enhancement of NK cell activity via DNA-sensing inhibition by Poxin transgene

    doi: 10.1016/j.jare.2025.05.058

    Figure Lengend Snippet: Poxin transgene enhances the cytotoxic activity of NK-92 cells. A. Cytotoxicity of NK-92 cells with and without Poxin expression against K562 cells was measured over 4 h. B-C. Cells were co-cultured with target K562 cells for indicated times. B. Apoptosis levels in effector cells were assessed by FACS. C. Protein expression levels were detected by western blotting. (Representative data shown). D-G. Cells were harvested after 24 h in culture, and extracted total RNA was analyzed by RNA sequencing. (C = mock cells; P = Pox-NK-92 cells; n = 3). D. Heatmap. E. GO analysis. F. Differentially expressed genes in NK-92 and Pox-NK-92 groups were categorized by function. G. Top 10 upstream transcription factors and target genes were analyzed by network analysis. H. NK cell activation pathway was analyzed by western blotting. (Representative data shown). I. Quantitative analysis of Perforin expression level. J. mRNA levels of cytotoxic factors were analyzed by RT-qPCR (n = 3).

    Article Snippet: The Poxin coding sequence (CDS) fragment was synthesized by Bioneer, and the H17A mutant Poxin (mtPoxin) fragment was generated via overlapping PCR.

    Techniques: Activity Assay, Expressing, Cell Culture, Western Blot, RNA Sequencing, Activation Assay, Quantitative RT-PCR

    Poxin enhances the anti-tumor capacity of NK-92 cells. A. Experimental scheme for mouse study (n = 4). B. Ventral bioluminescence (BLI) images following injection of NK92 or Pox-NK-92 cells. C. Quantification and statistical analysis (n = 4). D. Survival curves post-injection of K562-Luc cells. Data are presented as mean ± SEM. Mouse experiments were conducted independently twice, yielding consistent results.

    Journal: Journal of Advanced Research

    Article Title: Enhancement of NK cell activity via DNA-sensing inhibition by Poxin transgene

    doi: 10.1016/j.jare.2025.05.058

    Figure Lengend Snippet: Poxin enhances the anti-tumor capacity of NK-92 cells. A. Experimental scheme for mouse study (n = 4). B. Ventral bioluminescence (BLI) images following injection of NK92 or Pox-NK-92 cells. C. Quantification and statistical analysis (n = 4). D. Survival curves post-injection of K562-Luc cells. Data are presented as mean ± SEM. Mouse experiments were conducted independently twice, yielding consistent results.

    Article Snippet: The Poxin coding sequence (CDS) fragment was synthesized by Bioneer, and the H17A mutant Poxin (mtPoxin) fragment was generated via overlapping PCR.

    Techniques: Injection

    Poxin improves the anti-tumor efficacy of PD-L1-CAR-NK cells against H460 lung cancer. A. PD-L1-CAR expression levels in NK-92 cells. Abbreviations: TM = Transmembrane; Co-stim=Co-stimulatory; SD=Signaling domain. B. Cytotoxicity of CAR-NK-92 cells with or without Poxin expression against K562 and H460 cells, measured over 2 h. C. Experimental scheme for the H460 xenograft mouse model (n = 8). D. Tumor sizes were measured using digital calipers at the indicated time points. E. Representative tumor images from both groups at 28 days post-H460 inoculation. F. Tumor volumes were calculated. Error bars in panels B and D represent mean ± SEM. Mouse experiments were independently repeated twice with similar outcomes. Statistical significance was assessed using Two-way ANOVA (D) or Student's t -test (F).

    Journal: Journal of Advanced Research

    Article Title: Enhancement of NK cell activity via DNA-sensing inhibition by Poxin transgene

    doi: 10.1016/j.jare.2025.05.058

    Figure Lengend Snippet: Poxin improves the anti-tumor efficacy of PD-L1-CAR-NK cells against H460 lung cancer. A. PD-L1-CAR expression levels in NK-92 cells. Abbreviations: TM = Transmembrane; Co-stim=Co-stimulatory; SD=Signaling domain. B. Cytotoxicity of CAR-NK-92 cells with or without Poxin expression against K562 and H460 cells, measured over 2 h. C. Experimental scheme for the H460 xenograft mouse model (n = 8). D. Tumor sizes were measured using digital calipers at the indicated time points. E. Representative tumor images from both groups at 28 days post-H460 inoculation. F. Tumor volumes were calculated. Error bars in panels B and D represent mean ± SEM. Mouse experiments were independently repeated twice with similar outcomes. Statistical significance was assessed using Two-way ANOVA (D) or Student's t -test (F).

    Article Snippet: The Poxin coding sequence (CDS) fragment was synthesized by Bioneer, and the H17A mutant Poxin (mtPoxin) fragment was generated via overlapping PCR.

    Techniques: Expressing

    Expression of IRF1 and Type I interferon pathway-related proteins in gastric cancer cells. A : Simulation of type I interferon response in gastric cancer cells by incubating with interferon, showing increased expression of interferon pathway protein IRF1. B : Protein expression in gastric cancer cells after transfection with pcDNA3.1(+) -IRF1-HA.1 C : Protein expression in gastric cancer cells after transfection with siRNA-IRF1. D : Changes in the expression of interferon pathway proteins after overexpression or inhibition of IRF1 in gastric cancer cells

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: Expression of IRF1 and Type I interferon pathway-related proteins in gastric cancer cells. A : Simulation of type I interferon response in gastric cancer cells by incubating with interferon, showing increased expression of interferon pathway protein IRF1. B : Protein expression in gastric cancer cells after transfection with pcDNA3.1(+) -IRF1-HA.1 C : Protein expression in gastric cancer cells after transfection with siRNA-IRF1. D : Changes in the expression of interferon pathway proteins after overexpression or inhibition of IRF1 in gastric cancer cells

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Expressing, Transfection, Over Expression, Inhibition

    Expression characteristics and clinical relevance of IRF1 in gastric cancer tissues. A : IRF1 expression is significantly higher in gastric cancer tissues compared to adjacent normal tissues ( P < 0.001). B : Paired analysis shows that IRF1 expression is significantly upregulated in gastric cancer tissues compared to matched adjacent tissues ( P = 0.002). C : Survival analysis indicates that high IRF1 expression is associated with a relatively better prognosis in gastric cancer patients (Log-rank P = 0.030). D : Representative immunohistochemistry (IHC) images showing high and low IRF1 expression in tumor tissues. E : Differential expression analysis confirms that IRF1 is significantly upregulated in tumor tissues ( P = 0.021). F : Paired analysis of tumor and adjacent normal tissues demonstrates significantly higher IRF1 expression in tumors ( P < 0.001). G : Survival analysis further supports that high IRF1 expression correlates with a better prognosis in gastric cancer patients (Log-rank P = 0.010). * P < 0.05, ** P < 0.01, *** P < 0.001, *** P < 0.0001

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: Expression characteristics and clinical relevance of IRF1 in gastric cancer tissues. A : IRF1 expression is significantly higher in gastric cancer tissues compared to adjacent normal tissues ( P < 0.001). B : Paired analysis shows that IRF1 expression is significantly upregulated in gastric cancer tissues compared to matched adjacent tissues ( P = 0.002). C : Survival analysis indicates that high IRF1 expression is associated with a relatively better prognosis in gastric cancer patients (Log-rank P = 0.030). D : Representative immunohistochemistry (IHC) images showing high and low IRF1 expression in tumor tissues. E : Differential expression analysis confirms that IRF1 is significantly upregulated in tumor tissues ( P = 0.021). F : Paired analysis of tumor and adjacent normal tissues demonstrates significantly higher IRF1 expression in tumors ( P < 0.001). G : Survival analysis further supports that high IRF1 expression correlates with a better prognosis in gastric cancer patients (Log-rank P = 0.010). * P < 0.05, ** P < 0.01, *** P < 0.001, *** P < 0.0001

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Expressing, Immunohistochemistry, Quantitative Proteomics

    Effects of IRF1 expression on gastric cancer cell function. A - B : CCK8 cytotoxicity assay showing inhibition of AGS and BGC-823 cell proliferation after transfection with IRF1-HA overexpression plasmid. C - D : Transwell migration and invasion assay showing suppression of AGS and BGC-823 cell migration and invasion 48 h after transfection with IRF1-HA overexpression plasmid. E - F : CCK8 cytotoxicity assay showing promotion of AGS and BGC-823 cell proliferation after transfection with siRNA-IRF1. G - H : Transwell migration and invasion assay showing enhanced migration and invasion of AGS and BGC-823 cells 48 h after transfection with siRNA-IRF1. I : Flow cytometry apoptosis assay showing increased apoptosis in gastric cancer cells 48 h after Dox-induced IRF1 overexpression in stable cell lines. J : Changes in apoptosis-related protein expression 48 h after Dox-induced IRF1 overexpression in gastric cancer cell stable lines. K : Immunofluorescence localization experiment confirming nuclear localization of IRF1 in gastric cancer cells. Scale bar: 10 μm. * P < 0.05, ** P < 0.01, ** P < 0.001

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: Effects of IRF1 expression on gastric cancer cell function. A - B : CCK8 cytotoxicity assay showing inhibition of AGS and BGC-823 cell proliferation after transfection with IRF1-HA overexpression plasmid. C - D : Transwell migration and invasion assay showing suppression of AGS and BGC-823 cell migration and invasion 48 h after transfection with IRF1-HA overexpression plasmid. E - F : CCK8 cytotoxicity assay showing promotion of AGS and BGC-823 cell proliferation after transfection with siRNA-IRF1. G - H : Transwell migration and invasion assay showing enhanced migration and invasion of AGS and BGC-823 cells 48 h after transfection with siRNA-IRF1. I : Flow cytometry apoptosis assay showing increased apoptosis in gastric cancer cells 48 h after Dox-induced IRF1 overexpression in stable cell lines. J : Changes in apoptosis-related protein expression 48 h after Dox-induced IRF1 overexpression in gastric cancer cell stable lines. K : Immunofluorescence localization experiment confirming nuclear localization of IRF1 in gastric cancer cells. Scale bar: 10 μm. * P < 0.05, ** P < 0.01, ** P < 0.001

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Expressing, Cell Function Assay, Cytotoxicity Assay, Inhibition, Transfection, Over Expression, Plasmid Preparation, Migration, Invasion Assay, Flow Cytometry, Apoptosis Assay, Stable Transfection, Immunofluorescence

    Establishment of an Inducible IRF1 expression nude mouse subcutaneous xenograft and lung metastasis model. A : In vivo experiments show that the tumor volume of the IRF1 overexpression group in nude mouse subcutaneous xenografts is significantly smaller than that of the control group (Mean ± SEM). B : Gross anatomy of subcutaneous xenograft tumors in nude mice. C : HE staining of subcutaneous xenograft tumors (tumor tissues from mouse #1 and #2). D : Immunohistochemistry (IHC) analysis of IRF1 expression in subcutaneous xenograft tumors, showing significant IRF1 overexpression in the Dox (+) group. E : Bioluminescence imaging of nude mice injected via the tail vein with BGC-IRF1-LUC cells at 0, 2, 3, and 4 weeks post-injection. F : Quantification of lung fluorescence intensity in both groups, demonstrating significantly lower fluorescence intensity in the IRF1 overexpression group compared to the control group. G : Gross anatomy of lung tissues in nude mice, showing more metastatic nodules in the control group than in the IRF1 overexpression group. H : HE staining and IRF1-specific IHC staining of lung tissues in nude mice, confirming IRF1 overexpression in the Dox-induced group. Scale bar: 100 μm. * P < 0.05, ** P < 0.01, *** P < 0.001

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: Establishment of an Inducible IRF1 expression nude mouse subcutaneous xenograft and lung metastasis model. A : In vivo experiments show that the tumor volume of the IRF1 overexpression group in nude mouse subcutaneous xenografts is significantly smaller than that of the control group (Mean ± SEM). B : Gross anatomy of subcutaneous xenograft tumors in nude mice. C : HE staining of subcutaneous xenograft tumors (tumor tissues from mouse #1 and #2). D : Immunohistochemistry (IHC) analysis of IRF1 expression in subcutaneous xenograft tumors, showing significant IRF1 overexpression in the Dox (+) group. E : Bioluminescence imaging of nude mice injected via the tail vein with BGC-IRF1-LUC cells at 0, 2, 3, and 4 weeks post-injection. F : Quantification of lung fluorescence intensity in both groups, demonstrating significantly lower fluorescence intensity in the IRF1 overexpression group compared to the control group. G : Gross anatomy of lung tissues in nude mice, showing more metastatic nodules in the control group than in the IRF1 overexpression group. H : HE staining and IRF1-specific IHC staining of lung tissues in nude mice, confirming IRF1 overexpression in the Dox-induced group. Scale bar: 100 μm. * P < 0.05, ** P < 0.01, *** P < 0.001

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Expressing, In Vivo, Over Expression, Control, Staining, Immunohistochemistry, Imaging, Injection, Fluorescence

    Exploration of IRF1-related mechanisms. A : Schematic diagram of the IRF1 protein structure; DBD: DNA binding domain; IAD: IRF-association domain. B : Validation of successful expression of the pcDNA3.1(+)-IRF1Δ1 recombinant plasmid. C : No significant changes in apoptosis-related protein expression after IRF1Δ1 overexpression. D : Overexpression of IRF1 significantly affects PI3K pathway-related proteins, whereas IRF1Δ1 overexpression shows no apparent changes. E : Bidirectional validation of the interaction between IRF1 and MX2 using HA and Flag magnetic beads. F : Immunofluorescence co-localization analysis confirming the nuclear co-expression of IRF1 and MX2

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: Exploration of IRF1-related mechanisms. A : Schematic diagram of the IRF1 protein structure; DBD: DNA binding domain; IAD: IRF-association domain. B : Validation of successful expression of the pcDNA3.1(+)-IRF1Δ1 recombinant plasmid. C : No significant changes in apoptosis-related protein expression after IRF1Δ1 overexpression. D : Overexpression of IRF1 significantly affects PI3K pathway-related proteins, whereas IRF1Δ1 overexpression shows no apparent changes. E : Bidirectional validation of the interaction between IRF1 and MX2 using HA and Flag magnetic beads. F : Immunofluorescence co-localization analysis confirming the nuclear co-expression of IRF1 and MX2

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Binding Assay, Biomarker Discovery, Expressing, Recombinant, Plasmid Preparation, Over Expression, Magnetic Beads, Immunofluorescence

    MX2-related functions in gastric cancer. A : Schematic diagram of MX2 functional domain fragments. B : Co-IP assay validating the interaction between IRF1-HA and MX2-Flag, showing that IRF1 loses interaction with MX2-FlagΔ1. C : Schematic of MX2 site-directed mutations. K131A: GTP-binding defective, unable to enter the nucleus; NLS: nuclear localization signal; BSE: bundle signaling element. D : WB validation of MX2 site-directed mutant overexpression plasmids. E : MX2 overexpression promotes AGS cell migration and invasion. F : MX2 overexpression promotes BGC-823 cell migration and invasion. G : After transfecting MX2 and its mutants into BGC-823 cells and incubating for 48 h, nuclear localization site mutations in MX2 result in the loss of its pro-migratory and pro-invasive effects. H : Immunofluorescence localization of MX2 and its mutants in gastric cancer cells. After transfection with MX2-ΔN or MX2-K131A, MX2 is retained in the cytoplasm, losing its nuclear localization ability. I : WB validation of MX2’s pro-migratory function through EMT pathway analysis. Scale bar: 10 μm. * P < 0.05, ** P < 0.01, *** P < 0.001

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: MX2-related functions in gastric cancer. A : Schematic diagram of MX2 functional domain fragments. B : Co-IP assay validating the interaction between IRF1-HA and MX2-Flag, showing that IRF1 loses interaction with MX2-FlagΔ1. C : Schematic of MX2 site-directed mutations. K131A: GTP-binding defective, unable to enter the nucleus; NLS: nuclear localization signal; BSE: bundle signaling element. D : WB validation of MX2 site-directed mutant overexpression plasmids. E : MX2 overexpression promotes AGS cell migration and invasion. F : MX2 overexpression promotes BGC-823 cell migration and invasion. G : After transfecting MX2 and its mutants into BGC-823 cells and incubating for 48 h, nuclear localization site mutations in MX2 result in the loss of its pro-migratory and pro-invasive effects. H : Immunofluorescence localization of MX2 and its mutants in gastric cancer cells. After transfection with MX2-ΔN or MX2-K131A, MX2 is retained in the cytoplasm, losing its nuclear localization ability. I : WB validation of MX2’s pro-migratory function through EMT pathway analysis. Scale bar: 10 μm. * P < 0.05, ** P < 0.01, *** P < 0.001

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Functional Assay, Co-Immunoprecipitation Assay, Binding Assay, Biomarker Discovery, Mutagenesis, Over Expression, Migration, Immunofluorescence, Transfection

    Functional model of the IRF1-MX2 protein complex

    Journal: Cellular Oncology (Dordrecht, Netherlands)

    Article Title: IRF1 suppresses gastric tumorigenesis via dual PI3K/AKT-ERK pathway modulation and functional antagonism of oncogenic MX2

    doi: 10.1007/s13402-025-01134-w

    Figure Lengend Snippet: Functional model of the IRF1-MX2 protein complex

    Article Snippet: The IRF1 gene coding sequence (CDS) was retrieved from the National Center for Biotechnology Information (NCBI), selecting the longest transcript.

    Techniques: Functional Assay